matlab 2022 platform Search Results


96
Quanser Consulting quarc software
Quarc Software, supplied by Quanser Consulting, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quarc software/product/Quanser Consulting
Average 96 stars, based on 1 article reviews
quarc software - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
World Precision Instruments filament world precision instruments 1b150f
Filament World Precision Instruments 1b150f, supplied by World Precision Instruments, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/filament world precision instruments 1b150f/product/World Precision Instruments
Average 96 stars, based on 1 article reviews
filament world precision instruments 1b150f - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
Umetrics markerlyn
Markerlyn, supplied by Umetrics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/markerlyn/product/Umetrics
Average 90 stars, based on 1 article reviews
markerlyn - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
MathWorks Inc time based controller
Time Based Controller, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/time based controller/product/MathWorks Inc
Average 96 stars, based on 1 article reviews
time based controller - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
Mouse Specifics digigaittm imaging system
Digigaittm Imaging System, supplied by Mouse Specifics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/digigaittm imaging system/product/Mouse Specifics
Average 90 stars, based on 1 article reviews
digigaittm imaging system - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Mouse Specifics digigait™ analysis system
Digigait™ Analysis System, supplied by Mouse Specifics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/digigait™ analysis system/product/Mouse Specifics
Average 90 stars, based on 1 article reviews
digigait™ analysis system - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

97
MathWorks Inc local immunomodulation
Results from Phase 2 (Compilation of all in silico models to support vaccine development).
Local Immunomodulation, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/local immunomodulation/product/MathWorks Inc
Average 97 stars, based on 1 article reviews
local immunomodulation - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

96
MathWorks Inc vehicle vibration si test platform
Results from Phase 2 (Compilation of all in silico models to support vaccine development).
Vehicle Vibration Si Test Platform, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vehicle vibration si test platform/product/MathWorks Inc
Average 96 stars, based on 1 article reviews
vehicle vibration si test platform - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

91
Addgene inc n a cav2 cre montpellier vectorology platform n a aav5 pcag flex
Results from Phase 2 (Compilation of all in silico models to support vaccine development).
N A Cav2 Cre Montpellier Vectorology Platform N A Aav5 Pcag Flex, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n a cav2 cre montpellier vectorology platform n a aav5 pcag flex/product/Addgene inc
Average 91 stars, based on 1 article reviews
n a cav2 cre montpellier vectorology platform n a aav5 pcag flex - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

90
Bio-Serv doxyclyine mouse food
Results from Phase 2 (Compilation of all in silico models to support vaccine development).
Doxyclyine Mouse Food, supplied by Bio-Serv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/doxyclyine mouse food/product/Bio-Serv
Average 90 stars, based on 1 article reviews
doxyclyine mouse food - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Addgene inc paper n a c7orf26 avana grna
Figure 4. Modular pleiotropy within protein complexes resolves <t>C7orf26</t> as a member of the Integrator complex INTS10-13-14 module (A) STAGA and ATAC protein complexes share a histone acetyltransferase module. From cancer cell fitness data alone, Webster inferred separate functional effects of STAGA and ATAC depletion while decomposing the effect of knocking out shared subunits as a mixture of STAGA and ATAC depletion. (B) The SWI/SNF family protein complexes consist of specialized subunits bound to the common enzymatic subunit SMARCA4. From cancer cell fitness data alone, Webster inferred separate functional effects of depleting each subcomplex while decomposing the effect of SMARCA4 knockout as affecting all three subcomplexes. (C) The Integrator complex is a modular RNA endonuclease complex. From cancer cell fitness data alone, Webster learned three distinct functional effects involving Integrator complex componentry. Each of the three functions captured the specific effect of knocking out recently discovered structural modules of the
Paper N A C7orf26 Avana Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a c7orf26 avana grna/product/Addgene inc
Average 90 stars, based on 1 article reviews
paper n a c7orf26 avana grna - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Peninsula Laboratories anti-oxytocin (ps38)
Figure 4. Modular pleiotropy within protein complexes resolves <t>C7orf26</t> as a member of the Integrator complex INTS10-13-14 module (A) STAGA and ATAC protein complexes share a histone acetyltransferase module. From cancer cell fitness data alone, Webster inferred separate functional effects of STAGA and ATAC depletion while decomposing the effect of knocking out shared subunits as a mixture of STAGA and ATAC depletion. (B) The SWI/SNF family protein complexes consist of specialized subunits bound to the common enzymatic subunit SMARCA4. From cancer cell fitness data alone, Webster inferred separate functional effects of depleting each subcomplex while decomposing the effect of SMARCA4 knockout as affecting all three subcomplexes. (C) The Integrator complex is a modular RNA endonuclease complex. From cancer cell fitness data alone, Webster learned three distinct functional effects involving Integrator complex componentry. Each of the three functions captured the specific effect of knocking out recently discovered structural modules of the
Anti Oxytocin (Ps38), supplied by Peninsula Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-oxytocin (ps38)/product/Peninsula Laboratories
Average 90 stars, based on 1 article reviews
anti-oxytocin (ps38) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Results from Phase 2 (Compilation of all in silico models to support vaccine development).

Journal: Pharmaceutics

Article Title: In Silico Studies to Support Vaccine Development

doi: 10.3390/pharmaceutics15020654

Figure Lengend Snippet: Results from Phase 2 (Compilation of all in silico models to support vaccine development).

Article Snippet: Cancer vaccine , PBPK , To represent the distribution of certain molecules eluted through a 3D-printed implantable system named ‘NICHE’ , The NICHE platform aims to study immunomodulation for cell therapeutics and cancer vaccines. It is a two-compartment model composed of a vascularized tissue reservoir and a surrounding refillable drug reservoir. The PBPK model was able to recapitulate the biodistribution of the molecules in scope, and together with NICH, they represent a flexible, adaptable platform to investigate local immunomodulation for biomedical applications. , Simbiology (MATLAB 2021b, Mathworks) , Simone Capuani et al.; 2022 [ ] .

Techniques: In Silico, Software, Vaccines, Injection, Adjuvant, In Vivo, Formulation, Infection, Bioprocessing, Virus, Emulsion, Drug discovery, Neutralization, Concentration Assay, Biomarker Discovery, Construct, Binding Assay, Diffusion-based Assay, Recombinant, Immunopeptidomics, Solubility, Cloning

Figure 4. Modular pleiotropy within protein complexes resolves C7orf26 as a member of the Integrator complex INTS10-13-14 module (A) STAGA and ATAC protein complexes share a histone acetyltransferase module. From cancer cell fitness data alone, Webster inferred separate functional effects of STAGA and ATAC depletion while decomposing the effect of knocking out shared subunits as a mixture of STAGA and ATAC depletion. (B) The SWI/SNF family protein complexes consist of specialized subunits bound to the common enzymatic subunit SMARCA4. From cancer cell fitness data alone, Webster inferred separate functional effects of depleting each subcomplex while decomposing the effect of SMARCA4 knockout as affecting all three subcomplexes. (C) The Integrator complex is a modular RNA endonuclease complex. From cancer cell fitness data alone, Webster learned three distinct functional effects involving Integrator complex componentry. Each of the three functions captured the specific effect of knocking out recently discovered structural modules of the

Journal: Cell systems

Article Title: Sparse dictionary learning recovers pleiotropy from human cell fitness screens.

doi: 10.1016/j.cels.2021.12.005

Figure Lengend Snippet: Figure 4. Modular pleiotropy within protein complexes resolves C7orf26 as a member of the Integrator complex INTS10-13-14 module (A) STAGA and ATAC protein complexes share a histone acetyltransferase module. From cancer cell fitness data alone, Webster inferred separate functional effects of STAGA and ATAC depletion while decomposing the effect of knocking out shared subunits as a mixture of STAGA and ATAC depletion. (B) The SWI/SNF family protein complexes consist of specialized subunits bound to the common enzymatic subunit SMARCA4. From cancer cell fitness data alone, Webster inferred separate functional effects of depleting each subcomplex while decomposing the effect of SMARCA4 knockout as affecting all three subcomplexes. (C) The Integrator complex is a modular RNA endonuclease complex. From cancer cell fitness data alone, Webster learned three distinct functional effects involving Integrator complex componentry. Each of the three functions captured the specific effect of knocking out recently discovered structural modules of the

Article Snippet: 2020.05.040, Table S2 Cancer Dependency Map, 19Q4 release (fitness data for Webster input) https://depmap.org/portal/ https://doi.org/10.6084/m9. figshare.11384241.v3 Cancer Dependency Map, 21Q2 release (omics data for biomarker pipeline) https://depmap.org/portal/ https://doi.org/10.6084/m9. figshare.14541774.v2 PRISM Drug Repurposing data (Corsello et al., 2020) https://doi.org/10.6084/m9. figshare.9393293.v4 Human Cell Map (proximity ligation data) (Go et al., 2021) http://doi.org/10.1038/s41586- 021-03592-2 Experimental models: Cell lines 293FT Thermo Fisher Scientific R70007 Oligonucleotides INTS6 Avana gRNA (chr13_51452485_+): ATGGCTGCGCTGGTTCATAG This paper N/A INTS10 Avana gRNA (chr8_19823975_-) : TCTTAAACAACCTCTCCCAA This paper N/A C7orf26 Avana gRNA (chr7_6594465_+) : TTACTGTGTGAGGTTAGCCA This paper N/A Recombinant DNA lentiCRISPR v2-Blast Addgene 83480 pLEX_307 Addgene 41392 pLX_HA This study 178534 pLX_HA-C7orf26v1 This study 178535 pLX_HA-C7orf26v2 This study 178536 pLX_317-C7orf26v1 This study 178537 pLX_317-C7orf26v2 Broad Institute Gene Perturbation Platform TRCN0000477172 (https://portals. broadinstitute.org/gpp/public/gene/ details?geneId=79034) Software and algorithms R R Foundation https://www.r-project.org/ MATLAB MathWorks https://www.mathworks.com/ products/matlab.html gProfiler (Raudvere et al., 2019) https://biit.cs.ut.ee/gprofiler/ DGRDL (Yankelevsky and Elad, 2016) https://elad.cs.technion.ac.il/software/ gene_fn This study https://doi.org/10.5281/zenodo.5773076 graph_dictionary_learning Various open source codebases https://doi.org/10.5281/zenodo.5773078 e1 Cell Systems 13, 286–303.e1–e10, April 20, 2022

Techniques: Functional Assay, Knock-Out